Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4277582
End position: 4277605
Length: 24

DNA sequence
>NC_022904, from 4277582 to 4277605 (24 bp); Pandoraea pnomenusa 3kgm GCCCATGCCCGTGCCCACGCACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4277556-4278755	Sequence	U875_19660 - acetyl-CoA acetyltransferase (Protein is coded in complementary strand; from 4278755 to 4277556)