Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4294595
End position: 4294618
Length: 24

DNA sequence
>NC_022904, from 4294595 to 4294618 (24 bp); Pandoraea pnomenusa 3kgm GGCGGCTGCGGCGGCGCCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4293840-4294844	Sequence	U875_19725 - membrane protein (Protein is coded in complementary strand; from 4294844 to 4293840)