Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4351023
End position: 4351046
Length: 24

DNA sequence
>NC_022904, from 4351023 to 4351046 (24 bp); Pandoraea pnomenusa 3kgm GGCGCGGGCGCGGGCACGAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4350117-4351559	Sequence	U875_19985 - membrane protein (Protein is coded in complementary strand; from 4351559 to 4350117)