Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4894696
End position: 4894719
Length: 24

DNA sequence
>NC_022904, from 4894696 to 4894719 (24 bp); Pandoraea pnomenusa 3kgm TCGTGGTCATGGTCATGGTCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4894312-4895397	Sequence	U875_22555 - cobalamin biosynthesis protein CobW (Protein is coded in complementary strand; from 4895397 to 4894312)