Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4950048
End position: 4950074
Length: 27

DNA sequence
>NC_022904, from 4950048 to 4950074 (27 bp); Pandoraea pnomenusa 3kgm ACCTTCACCACCTTCACTCCCTTCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4950028-4951008	Sequence	U875_22805 - hypothetical protein (Protein is coded in complementary strand; from 4951008 to 4950028)