Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 5089464
End position: 5089505
Length: 42

DNA sequence
>NC_022904, from 5089464 to 5089505 (42 bp); Pandoraea pnomenusa 3kgm GTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5088949-5089875	Sequence	U875_23415 - cobalt transporter (Protein is coded in complementary strand; from 5089875 to 5088949)