Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 5168973
End position: 5168996
Length: 24

DNA sequence
>NC_022904, from 5168973 to 5168996 (24 bp); Pandoraea pnomenusa 3kgm TCGGTGTCGGTGTCGTTGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5168931-5169395	Sequence	U875_23730 - hypothetical protein (Protein is coded in complementary strand; from 5169395 to 5168931)