Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 5388939
End position: 5388974
Length: 36

DNA sequence
>NC_022904, from 5388939 to 5388974 (36 bp); Pandoraea pnomenusa 3kgm GTGTCGGGCGTGTCGGGCGTGCCGGGCGTGCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5388837-5389883	Sequence	U875_24700 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 5389883 to 5388837)