Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 594622
End position: 594657
Length: 36

DNA sequence
>NC_022904, from 594622 to 594657 (36 bp); Pandoraea pnomenusa 3kgm CTTTCTCGCCTTTCTCGCCCTTCTCGCCTTTCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 594456-595556	Sequence	U875_02770 - diadenosine tetraphosphatase (Protein is coded in complementary strand; from 595556 to 594456)