Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 649002
End position: 649028
Length: 27

DNA sequence
>NC_022904, from 649002 to 649028 (27 bp); Pandoraea pnomenusa 3kgm GACGAATCCGACGAATCCGACGAATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 648030-649079	Sequence	U875_03035 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 649079 to 648030)