Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 733256
End position: 733303
Length: 48

DNA sequence
>NC_022904, from 733256 to 733303 (48 bp); Pandoraea pnomenusa 3kgm GCCACGACCCTCGCCACGACCCTCGCCACGACCCTCGCCACGACCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 731862-735233	Sequence	U875_03405 - ribonuclease E (Protein is coded in complementary strand; from 735233 to 731862)