Sequence retrieval

Genome: Methanobacterium sp. MB1
Start position: 1659292
End position: 1659315
Length: 24

DNA sequence
>NC_023044, from 1659292 to 1659315 (24 bp); Methanobacterium sp. MB1 CTTCTTCTTCATCTCCTTCTCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1659105-1659824	Sequence	MBMB1_1677 mtrA1 Tetrahydromethanopterin S-methyltransferase subunit A 1 (Protein is coded in complementary strand; from 1659824 to 1659105)