Sequence retrieval

Genome: Methanobacterium sp. MB1
Start position: 431664
End position: 431687
Length: 24

DNA sequence
>NC_023044, from 431664 to 431687 (24 bp); Methanobacterium sp. MB1 AGCTGCAGCTGGGGCTGCGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 431572-431880	Sequence	MBMB1_0441 - hypothetical protein (Protein is coded in complementary strand; from 431880 to 431572)