Sequence retrieval

Genome: Methanobacterium sp. MB1
Start position: 432009
End position: 432032
Length: 24

DNA sequence
>NC_023044, from 432009 to 432032 (24 bp); Methanobacterium sp. MB1 TCCTCTTCCTCGTCTTCTTCCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 431976-432980	Sequence	MBMB1_0442 rplP0 Acidic ribosomal protein P0 homolog (Protein is coded in complementary strand; from 432980 to 431976)