Sequence retrieval

Genome: Methanobacterium sp. MB1
Start position: 1421399
End position: 1421434
Length: 36

DNA sequence
>NC_023044, from 1421399 to 1421434 (36 bp); Methanobacterium sp. MB1 CAGGAGCTGGTGCTGGAGCTGGTGCTGGAGCTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1421356-1421715	Sequence	MBMB1_1446 - hypothetical protein (Protein is coded in complementary strand; from 1421715 to 1421356)