Sequence retrieval

Genome: Methanobacterium sp. MB1
Start position: 1816154
End position: 1816189
Length: 36

DNA sequence
>NC_023044, from 1816154 to 1816189 (36 bp); Methanobacterium sp. MB1 GATGATATGAAAGAGGATATTAAAGATGCTAAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1816161-1817009	Sequence	MBMB1_1861 - putative Modification methylase BamHII (N-4 cytosine-specific methyltransferase BamHII) (M,BamHII)