Sequence retrieval

Genome: Methanobacterium sp. MB1
Start position: 338159
End position: 338212
Length: 54

DNA sequence
>NC_023044, from 338159 to 338212 (54 bp); Methanobacterium sp. MB1 GTCTAGTGGTTCTTGGTTTTCTAGTGCTTCATGGTTTTCTAGTGGTTCTTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 337803-338789	Sequence	MBMB1_0342 - hypothetical protein (Protein is coded in complementary strand; from 338789 to 337803)