Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 1177614
End position: 1177649
Length: 36

DNA sequence
>NC_023045, from 1177614 to 1177649 (36 bp); Alteromonas macleodii str. Aegean Sea MED64 GCACTATCCGCACTATCCGCACTATCCGCACTATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1177434-1179692	Sequence	I533_05330 - hypothetical protein (Protein is coded in complementary strand; from 1179692 to 1177434)