Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 2623319
End position: 2623366
Length: 48

DNA sequence
>NC_023045, from 2623319 to 2623366 (48 bp); Alteromonas macleodii str. Aegean Sea MED64 GGTATCACCACCTGTGTCACCACCGGTATCACCACCGGTATCACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2620839-2624879	Sequence	I533_11680 - extracellular ribonuclease/nuclease fusion protein (Protein is coded in complementary strand; from 2624879 to 2620839)