Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 2760033
End position: 2760056
Length: 24

DNA sequence
>NC_023045, from 2760033 to 2760056 (24 bp); Alteromonas macleodii str. Aegean Sea MED64 TTGTCTTGGTCTTTGTTTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2759994-2760239	Sequence	I533_12275 - hypothetical protein (Protein is coded in complementary strand; from 2760239 to 2759994)