Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 2787850
End position: 2787903
Length: 54

DNA sequence
>NC_023045, from 2787850 to 2787903 (54 bp); Alteromonas macleodii str. Aegean Sea MED64 TCAGGGCTGTTACTTAGCTCAGGGCTGTTACTTAGCTCAGGGCTGTTAATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2786968-2789742	Sequence	I533_12385 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 2789742 to 2786968)