Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 3112394
End position: 3112438
Length: 45

DNA sequence
>NC_023045, from 3112394 to 3112438 (45 bp); Alteromonas macleodii str. Aegean Sea MED64 ATAGAGCCAAGCAAGATACACCAAAGCAAGATAGAGCACAGCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3111287-3113326	Sequence	I533_13775 - RecQ domain-containing protein