Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 3459312
End position: 3459359
Length: 48

DNA sequence
>NC_023045, from 3459312 to 3459359 (48 bp); Alteromonas macleodii str. Aegean Sea MED64 ATCGCTTGGGTTATCGCCTAGGTTACCGCTTGGGTAATCGCTTGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3458221-3459393	Sequence	I533_15285 - hemin ABC transporter pemease component (Protein is coded in complementary strand; from 3459393 to 3458221)