Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 4192137
End position: 4192163
Length: 27

DNA sequence
>NC_023045, from 4192137 to 4192163 (27 bp); Alteromonas macleodii str. Aegean Sea MED64 CATGCCGCCCATTCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4192132-4193772	Sequence	I533_18375 - chaperonin GroEL (Protein is coded in complementary strand; from 4193772 to 4192132)