Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 517540
End position: 517575
Length: 36

DNA sequence
>NC_023045, from 517540 to 517575 (36 bp); Alteromonas macleodii str. Aegean Sea MED64 TCCTTTTAAGCGTCTTTTTAGGCGTCTTTTTAAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 517570-518481	Sequence	I533_02320 - ornithine carbamoyltransferase (Protein is coded in complementary strand; from 518481 to 517570)