Sequence retrieval

Genome: Alteromonas macleodii str. Aegean Sea MED64
Start position: 737139
End position: 737162
Length: 24

DNA sequence
>NC_023045, from 737139 to 737162 (24 bp); Alteromonas macleodii str. Aegean Sea MED64 TCGTCTTCTTCTTCGTCTTCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 735924-737759	Sequence	I533_03335 - RNA polymerase sigma factor (Protein is coded in complementary strand; from 737759 to 735924)