Sequence retrieval

Genome: Sulfolobus acidocaldarius SUSAZ
Start position: 1497859
End position: 1497882
Length: 24

DNA sequence
>NC_023069, from 1497859 to 1497882 (24 bp); Sulfolobus acidocaldarius SUSAZ TTATTATTATTATCATTATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1497265-1498506	Sequence	SUSAZ_08515 - MFS transporter (Protein is coded in complementary strand; from 1498506 to 1497265)