Sequence retrieval

Genome: Sulfolobus acidocaldarius SUSAZ
Start position: 376102
End position: 376126
Length: 25

DNA sequence
>NC_023069, from 376102 to 376126 (25 bp); Sulfolobus acidocaldarius SUSAZ TTTACTTTAATTTCCTTTAGTTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 375967-376944	Sequence	SUSAZ_02190 - peptide ABC transporter ATPase (Protein is coded in complementary strand; from 376944 to 375967)