Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 162962
End position: 162985
Length: 24

DNA sequence
>NC_023134, from 162962 to 162985 (24 bp); Paenibacillus larvae subsp. larvae DSM 25430 ATTTGATTTTGAATTTGGATTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 162925-163251	Sequence	ERIC2_c01540 - hypothetical protein (Protein is coded in complementary strand; from 163251 to 162925)