Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 180534
End position: 180557
Length: 24

DNA sequence
>NC_023134, from 180534 to 180557 (24 bp); Paenibacillus larvae subsp. larvae DSM 25430 TTTCTTTCTCTTTTTCTATTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 180492-180626	Sequence	ERIC2_c01711 - hypothetical protein (Protein is coded in complementary strand; from 180626 to 180492)