Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 1857451
End position: 1857477
Length: 27

DNA sequence
>NC_023134, from 1857451 to 1857477 (27 bp); Paenibacillus larvae subsp. larvae DSM 25430 CGATTTGTTCTATTTGTTCTATTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1849020-1865129	Sequence	ERIC2_c18760 - nonribosomal peptide ligase subunit (Protein is coded in complementary strand; from 1865129 to 1849020)