Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 1936439
End position: 1936462
Length: 24

DNA sequence
>NC_023134, from 1936439 to 1936462 (24 bp); Paenibacillus larvae subsp. larvae DSM 25430 TTCACCTTCCCCTTCAGCTTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1936092-1936520	Sequence	ERIC2_c19370 cwlJ cell wall hydrolase CwlJ (Protein is coded in complementary strand; from 1936520 to 1936092)