Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 2126113
End position: 2126139
Length: 27

DNA sequence
>NC_023134, from 2126113 to 2126139 (27 bp); Paenibacillus larvae subsp. larvae DSM 25430 GATTGGACGGATTGGACGGATTGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2124607-2127012	Sequence	ERIC2_c21040 ftsK DNA translocase FtsK (Protein is coded in complementary strand; from 2127012 to 2124607)