Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 2397737
End position: 2397760
Length: 24

DNA sequence
>NC_023134, from 2397737 to 2397760 (24 bp); Paenibacillus larvae subsp. larvae DSM 25430 CTGGTTCTGGTTCTGATTTTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2397456-2397977	Sequence	ERIC2_c24010 - hypothetical protein (Protein is coded in complementary strand; from 2397977 to 2397456)