Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 2528236
End position: 2528280
Length: 45

DNA sequence
>NC_023134, from 2528236 to 2528280 (45 bp); Paenibacillus larvae subsp. larvae DSM 25430 TGGATTTGGACAAATTGGATTTGGACAAATTGGATTTGGACAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2527029-2528450	Sequence	ERIC2_c25280 - ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein (Protein is coded in complementary strand; from 2528450 to 2527029)