Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 3332443
End position: 3332487
Length: 45

DNA sequence
>NC_023134, from 3332443 to 3332487 (45 bp); Paenibacillus larvae subsp. larvae DSM 25430 ATAGCCACCGCTCCTATAGCCACCTTGCCTATAGCTACGGCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3332252-3332500	Sequence	ERIC2_c33790 - hypothetical protein (Protein is coded in complementary strand; from 3332500 to 3332252)