Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 3351166
End position: 3351195
Length: 30

DNA sequence
>NC_023134, from 3351166 to 3351195 (30 bp); Paenibacillus larvae subsp. larvae DSM 25430 ACTTTTATATACTTTTATATACTTTTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3351171-3351725	Sequence	ERIC2_c33980 - transglycosylase SLT domain protein (Protein is coded in complementary strand; from 3351725 to 3351171)