Sequence retrieval

Genome: Paenibacillus larvae subsp. larvae DSM 25430
Start position: 824166
End position: 824201
Length: 36

DNA sequence
>NC_023134, from 824166 to 824201 (36 bp); Paenibacillus larvae subsp. larvae DSM 25430 AGGACCAGGACCAGGAGAAGGACCAGGACCAGGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 823729-824565	Sequence	ERIC2_c08370 - hypothetical protein (Protein is coded in complementary strand; from 824565 to 823729)