Microsatellites /Tandem Repeats database

Genome: Deinococcus deserti VCD115

Search your sequence for microsatellites

This database allows retrieval of precomputed tandem repeats from the selected genome. It also allows to easily design primers for amplification of a DNA fragment containing the tandem repeat. The primers may be used for PCR simulation with a specific genome or with all genomes within the selected genera.
Info

Percentaje of mismatches allowed within the tandem repeats: 0 | 0.1 | 0.2
 
PositionSequence 
880986GCAGGACCGGCGGGGCCAGCAGGACCGGCAGGGCCAGCAGGACCGGCAGGGCCADesign primers

Please help us improve this resource by reporting problems, suggestions etc.